Elife. 2023 May 9;12:e83152. doi: 10.7554/eLife.83152. Online ahead of print.

ABSTRACT

Ecological relationships between bacteria mediate the services that gut microbiomes provide to their hosts. Knowing the overall direction and strength of these relationships is essential to learn how ecology scales up to affect microbiome assembly, dynamics, and host health. However, whether bacterial relationships are generalizable across hosts or personalized to individual hosts is debated. Several eco-evolutionary processes could personalize microbiome community ecology, but the few studies that have tested this idea find that bacterial interactions are largely consistent (i.e., 'universal') across hosts. Here we apply a robust, multinomial logistic-normal modeling framework to extensive time series data (5,534 samples from 56 wild baboons over 13 years) to infer thousands of correlations in bacterial abundance in individual hosts and test the degree to which bacterial abundance correlations are 'universal'. We also compare these patterns to two human data sets. We find that, in baboons, most bacterial correlations are weak, negative, and universal across hosts, such that shared correlation patterns dominate over host-specific correlations by almost 2-fold. Further, taxon pairs that had inconsistent correlation signs (either positive or negative) in different hosts always had weak correlations within hosts. From the host perspective, host pairs with the most similar bacterial correlation patterns also had similar microbiome taxonomic compositions and tended to be genetic relatives. Compared to humans, universality in baboons was similar to that in human infants, and stronger than one data set from human adults. Bacterial families that showed universal correlations in human infants also tended to show universal correlations in baboons. Together, our work contributes new tools for analyzing the universality of bacterial associations across hosts, with implications for microbiome personalization, community assembly and stability, and for designing microbiome interventions to improve host health.

PMID:37158607 | DOI:10.7554/eLife.83152

Elife. 2023 May 9;12:e79444. doi: 10.7554/eLife.79444. Online ahead of print.

ABSTRACT

The heat shock response (HSR) controls expression of molecular chaperones to maintain protein homeostasis. Previously, we proposed a feedback loop model of the HSR in which heat-denatured proteins sequester the chaperone Hsp70 to activate the HSR, and subsequent induction of Hsp70 deactivates the HSR (Krakowiak et al., 2018; Zheng et al., 2016). However, recent work has implicated newly synthesized proteins (NSPs) - rather than unfolded mature proteins - and the Hsp70 co-chaperone Sis1 in HSR regulation, yet their contributions to HSR dynamics have not been determined. Here we generate a new mathematical model that incorporates NSPs and Sis1 into the HSR activation mechanism, and we perform genetic decoupling and pulse-labeling experiments to demonstrate that Sis1 induction is dispensable for HSR deactivation. Rather than providing negative feedback to the HSR, transcriptional regulation of Sis1 by Hsf1 promotes fitness by coordinating stress granules and carbon metabolism. These results support an overall model in which NSPs signal the HSR by sequestering Sis1 and Hsp70, while induction of Hsp70 - but not Sis1 - attenuates the response.

PMID:37158601 | DOI:10.7554/eLife.79444

Nucleic Acids Res. 2023 May 9:gkad383. doi: 10.1093/nar/gkad383. Online ahead of print.

ABSTRACT

Protein phosphorylation, catalyzed by protein kinases (PKs), is one of the most important post-translational modifications (PTMs), and involved in regulating almost all of biological processes. Here, we report an updated server, Group-based Prediction System (GPS) 6.0, for prediction of PK-specific phosphorylation sites (p-sites) in eukaryotes. First, we pre-trained a general model using penalized logistic regression (PLR), deep neural network (DNN), and Light Gradient Boosting Machine (LightGMB) on 490 762 non-redundant p-sites in 71 407 proteins. Then, transfer learning was conducted to obtain 577 PK-specific predictors at the group, family and single PK levels, using a well-curated data set of 30 043 known site-specific kinase-substrate relations in 7041 proteins. Together with the evolutionary information, GPS 6.0 could hierarchically predict PK-specific p-sites for 44046 PKs in 185 species. Besides the basic statistics, we also offered the knowledge from 22 public resources to annotate the prediction results, including the experimental evidence, physical interactions, sequence logos, and p-sites in sequences and 3D structures. The GPS 6.0 server is freely available at https://gps.biocuckoo.cn. We believe that GPS 6.0 could be a highly useful service for further analysis of phosphorylation.

PMID:37158278 | DOI:10.1093/nar/gkad383

Nucleic Acids Res. 2023 May 9:gkad366. doi: 10.1093/nar/gkad366. Online ahead of print.

ABSTRACT

Tyrosine-type site-specific recombinases (Y-SSRs) are versatile tools for genome engineering due to their ability to mediate excision, integration, inversion and exchange of genomic DNA with single nucleotide precision. The ever-increasing need for sophisticated genome engineering is driving efforts to identify novel SSR systems with intrinsic properties more suitable for particular applications. In this work, we develop a systematic computational workflow for annotation of putative Y-SSR systems and apply this pipeline to identify and characterize eight new naturally occurring Cre-type SSR systems. We test their activity in bacterial and mammalian cells and establish selectivity profiles for the new and already established Cre-type SSRs with regard to their ability to mutually recombine their target sites. These data form the basis for sophisticated genome engineering experiments using combinations of Y-SSRs in research fields including advanced genomics and synthetic biology. Finally, we identify putative pseudo-sites and potential off-targets for Y-SSRs in the human and mouse genome. Together with established methods for altering the DNA-binding specificity of this class of enzymes, this work should facilitate the use of Y-SSRs for future genome surgery applications.

PMID:37158248 | DOI:10.1093/nar/gkad366

Plant Dis. 2023 May 8. doi: 10.1094/PDIS-03-23-0581-PDN. Online ahead of print.

ABSTRACT

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

PMID:37157098 | DOI:10.1094/PDIS-03-23-0581-PDN

Nat Methods. 2023 May 8. doi: 10.1038/s41592-023-01873-4. Online ahead of print.

ABSTRACT

Evolutionarily conserved signaling pathways are essential for early embryogenesis, and reducing or abolishing their activity leads to characteristic developmental defects. Classification of phenotypic defects can identify the underlying signaling mechanisms, but this requires expert knowledge and the classification schemes have not been standardized. Here we use a machine learning approach for automated phenotyping to train a deep convolutional neural network, EmbryoNet, to accurately identify zebrafish signaling mutants in an unbiased manner. Combined with a model of time-dependent developmental trajectories, this approach identifies and classifies with high precision phenotypic defects caused by loss of function of the seven major signaling pathways relevant for vertebrate development. Our classification algorithms have wide applications in developmental biology and robustly identify signaling defects in evolutionarily distant species. Furthermore, using automated phenotyping in high-throughput drug screens, we show that EmbryoNet can resolve the mechanism of action of pharmaceutical substances. As part of this work, we freely provide more than 2 million images that were used to train and test EmbryoNet.

PMID:37156842 | DOI:10.1038/s41592-023-01873-4

Cell Discov. 2023 May 9;9(1):47. doi: 10.1038/s41421-023-00544-0.

ABSTRACT

Biomolecular condensates play key roles in various biological processes. However, specific condensation modulators are currently lacking. PROTAC is a new technology that can use small molecules to degrade target proteins specifically. PROTAC molecules are expected to regulate biomolecular condensates dynamically by degrading/recovering key molecules in biomolecular condensates. In this study, we employed a BRD4-targeting PROTAC molecule to regulate the super-enhancer (SE) condensate and monitored the changes of SE condensate under PROTAC treatment using live-cell imaging and high-throughput sequencing technologies. As a result, we found that BRD4-targeting PROTACs can significantly reduce the BRD4 condensates, and we established a quantitative method for tracking BRD4 condensates by PROTAC and cellular imaging. Surprisingly and encouragingly, BRD4 condensates were observed to preferentially form and play specialized roles in biological process regulation for the first time. Additionally, BRD4 PROTAC makes it possible to observe the dynamics of other condensate components under the continued disruption of BRD4 condensates. Together, these results shed new light on research methods for liquid-liquid phase separation (LLPS), and specifically demonstrate that PROTAC presents a powerful and distinctive tool for the study of biomolecular condensates.

PMID:37156794 | DOI:10.1038/s41421-023-00544-0

Adv Sci (Weinh). 2023 May 8:e2300115. doi: 10.1002/advs.202300115. Online ahead of print.

ABSTRACT

Chemotherapy resistance and treatment failure hinder clinical cancer treatment. Src, the first mammalian proto-oncogene to be discovered, is a valuable anti-cancer therapeutic target. Although several c-Src inhibitors have reached the clinical stage, drug resistance remains a challenge during treatment. Herein, a positive feedback loop between a previously uncharacterized long non-coding RNA (lncRNA), which the authors renamed lncRNA-inducing c-Src tumor-promoting function (LIST), and c-Src is uncovered. LIST directly binds to and regulates the Y530 phosphorylation activity of c-Src. As a c-Src agonist, LIST promotes tumor chemoresistance and progression in vitro and in vivo in multiple cancer types. c-Src can positively regulate LIST transcription by activating the NF-κB signaling pathway and then recruiting the P65 transcription factor to the LIST promoter. Interestingly, the LIST/c-Src interaction is associated with evolutionary new variations of c-Src. It is proposed that the human-specific LIST/c-Src axis renders an extra layer of control over c-Src activity. Additionally, the LIST/c-Src axis is of high physiological relevance in cancer and may be a valuable prognostic biomarker and potential therapeutic target.

PMID:37156751 | DOI:10.1002/advs.202300115

BMB Rep. 2023 May 9:5905. Online ahead of print.

ABSTRACT

RNAs are pivotal molecules acting as messengers of genetic information and regulatory molecules for cellular development and survival. From birth to death, RNAs face constant cellular decision for the precise control of cellular function and activity. Most eukaryotic cells employ conserved machineries for RNA decay including RNA silencing and RNA quality control (RQC). In plants, RQC monitors endogenous RNAs and degrades aberrant and dysfunctional species, whereas RNA silencing promotes RNA degradation to repress the expression of selected endogenous RNAs or exogenous RNA derived from transgenes and virus. Interestingly, emerging evidences have indicated that RQC and RNA silencing interact with each by sharing target RNAs and regulatory components. Such interaction should be tightly organized for proper cellular survival. However, it is still elusive that how each machinery specifically recognizes target RNAs. In this review, we summarize recent advances on RNA silencing and RQC pathway and discuss potential mechanisms underlying the interaction between the two machineries.

PMID:37156633

Free Radic Biol Med. 2023 May 6:S0891-5849(23)00398-2. doi: 10.1016/j.freeradbiomed.2023.04.021. Online ahead of print.

ABSTRACT

KEAP1 promotes the ubiquitin-dependent degradation of NRF2 by assembling into a CUL3-dependent ubiquitin ligase complex. Oxidative and electrophilic stress inhibit KEAP1 allowing NRF2 to accumulate for the transactivation of stress response genes. To date there are no structures of the KEAP1-CUL3 interaction nor binding data to show the contributions of different domains to their binding affinity. We determined a crystal structure of the BTB and 3-box domains of human KEAP1 in complex with the CUL3 N-terminal domain that showed a heterotetrameric assembly with 2:2 stoichiometry. To support the structural data, we developed a versatile TR-FRET-based assay system to profile the binding of BTB-domain-containing proteins to CUL3 and determine the contribution of distinct protein features, revealing the importance of the CUL3 N-terminal extension for high affinity binding. We further provide direct evidence that the investigational drug CDDO does not disrupt the KEAP1-CUL3 interaction, even at high concentrations, but reduces the affinity of KEAP1-CUL3 binding. The TR-FRET-based assay system offers a generalizable platform for profiling this protein class and may form a suitable screening platform for ligands that disrupt these interactions by targeting the BTB or 3-box domains to block E3 ligase function.

PMID:37156295 | DOI:10.1016/j.freeradbiomed.2023.04.021

Proc Natl Acad Sci U S A. 2023 May 16;120(20):e2302191120. doi: 10.1073/pnas.2302191120. Epub 2023 May 8.

ABSTRACT

Circular RNAs (circRNAs) are a class of RNAs commonly found across eukaryotes and viruses, characterized by their resistance to exonuclease-mediated degradation. Their superior stability compared to linear RNAs, combined with previous work showing that engineered circRNAs serve as efficient protein translation templates, make circRNA a promising candidate for RNA medicine. Here, we systematically examine the adjuvant activity, route of administration, and antigen-specific immunity of circRNA vaccination in mice. Potent circRNA adjuvant activity is associated with RNA uptake and activation of myeloid cells in the draining lymph nodes and transient cytokine release. Immunization of mice with engineered circRNA encoding a protein antigen delivered by a charge-altering releasable transporter induced innate activation of dendritic cells, robust antigen-specific CD8 T cell responses in lymph nodes and tissues, and strong antitumor efficacy as a therapeutic cancer vaccine. These results highlight the potential utility of circRNA vaccines for stimulating potent innate and T cell responses in tissues.

PMID:37155869 | DOI:10.1073/pnas.2302191120

ACS Sens. 2023 May 8. doi: 10.1021/acssensors.3c00228. Online ahead of print.

ABSTRACT

Developing functional materials that directly integrate into miniaturized devices for sensing applications is essential for constructing the next-generation point-of-care system. Although crystalline structure materials such as metal organic frameworks are attractive materials exhibiting promising potential for biosensing, their integration into miniaturized devices is limited. Dopamine (DA) is a major neurotransmitter released by dopaminergic neurons and has huge implications in neurodegenerative diseases. Integrated microfluidic biosensors capable of sensitive monitoring of DA from mass-limited samples is thus of significant importance. In this study, we developed and systematically characterized a microfluidic biosensor functionalized with the hybrid material composed of indium phosphate and polyaniline nanointerfaces for DA detection. Under the flowing operation, this biosensor displays a linear dynamic sensing range going from 10-18 to 10-11 M and a limit of detection (LOD) value of 1.83 × 10-19 M. In addition to the high sensitivity, this microfluidic sensor showed good selectivity toward DA and high stability (>1000 cycles). Further, the reliability and practical utility of the microfluidic biosensor were demonstrated using the neuro-2A cells treated with the activator, promoter, and inhibiter. These promising results underscore the importance and potential of microfluidic biosensors integrated with hybrid materials as advanced biosensors systems.

PMID:37155824 | DOI:10.1021/acssensors.3c00228

Protein Cell. 2023 May 8;14(5):376-381. doi: 10.1093/procel/pwac009.

NO ABSTRACT

PMID:37155316 | DOI:10.1093/procel/pwac009

J Phys Chem B. 2023 May 8. doi: 10.1021/acs.jpcb.3c00698. Online ahead of print.

ABSTRACT

Intrinsically disordered protein regions (IDRs) make up over 30% of the human proteome and exist in a dynamic conformational ensemble instead of a native, well-folded structure. Tethering IDRs to a surface (for example, the surface of a well-folded region of the same protein) can reduce the number of accessible conformations in these ensembles. This reduces the ensemble's conformational entropy, generating an effective entropic force that pulls away from the point of tethering. Recent experimental work has shown that this entropic force causes measurable, physiologically relevant changes to protein function. But how the magnitude of this force depends on IDR sequence remains unexplored. Here, we use all-atom simulations to analyze how structural preferences in IDR ensembles contribute to the entropic force they exert upon tethering. We show that sequence-encoded structural preferences play an important role in determining the magnitude of this force: compact, spherical ensembles generate an entropic force that can be several times higher than more extended ensembles. We further show that changes in the surrounding solution's chemistry can modulate the IDR entropic force strength. We propose that the entropic force is a sequence-dependent, environmentally tunable property of terminal IDR sequences.

PMID:37155239 | DOI:10.1021/acs.jpcb.3c00698

World J Pediatr. 2023 May 8. doi: 10.1007/s12519-023-00726-6. Online ahead of print.

ABSTRACT

BACKGROUND: Advances in cancer treatments, particularly the development of radiation therapy, have led to improvements in survival outcomes in children with brain tumors. However, radiation therapy is associated with significant long-term neurocognitive morbidity. The present systematic review and meta-analysis aimed to compare the neurocognitive outcomes of children and adolescents with brain tumors treated with photon radiation (XRT) or proton therapy (PBRT).

METHODS: A systematic search was conducted (PubMed, Embase, Cochrane, and Web of Science from inception until 02/01/2022) for studies comparing the neurocognitive outcomes of children and adolescents with brain tumors treated with XRT vs. PBRT. The pooled mean differences (expressed as Z scores) were calculated using a random effects method for those endpoints analyzed by a minimum of three studies.

RESULTS: Totally 10 studies (n = 630 patients, average age range: 1-20 years) met the inclusion criteria. Patients who had received PBRT achieved significantly higher scores (difference in Z scores ranging from 0.29-0.75, all P < 0.05 and significant in sensitivity analyses) after treatment than those who had received XRT for most analyzed neurocognitive outcomes (i.e., intelligence quotient, verbal comprehension and perceptual reasoning indices, visual motor integration, and verbal memory). No robust significant differences (P > 0.05 in main analyses or sensitivity analyses) were found for nonverbal memory, verbal working memory and working memory index, processing speed index, or focused attention.

CONCLUSIONS: Pediatric brain tumor patients who receive PBRT achieve significantly higher scores on most neurocognitive outcomes than those who receive XRT. Larger studies with long-term follow-ups are needed to confirm these results.

PMID:37154861 | DOI:10.1007/s12519-023-00726-6

Microbiol Spectr. 2023 May 8:e0501522. doi: 10.1128/spectrum.05015-22. Online ahead of print.

ABSTRACT

Mycobacteriophages are viruses that specifically infect mycobacteria and which, due to their diversity, represent a large gene pool. Characterization of the function of these genes should provide useful insights into host-phage interactions. Here, we describe a next-generation sequencing (NGS)-based, high-throughput screening approach for the identification of mycobacteriophage-encoded proteins that are toxic to mycobacteria. A plasmid-derived library representing the mycobacteriophage TM4 genome was constructed and transformed into Mycobacterium smegmatis. NGS and growth assays showed that the expression of TM4 gp43, gp77, -78, and -79, or gp85 was toxic to M. smegmatis. Although the genes associated with bacterial toxicity were expressed during phage infection, they were not required for lytic replication of mycobacteriophage TM4. In conclusion, we describe here an NGS-based approach which required significantly less time and resources than traditional methods and allowed the identification of novel mycobacteriophage gene products that are toxic to mycobacteria. IMPORTANCE The wide spread of drug-resistant Mycobacterium tuberculosis has brought an urgent need for new drug development. Mycobacteriophages are natural killers of M. tuberculosis, and their toxic gene products might provide potential anti-M. tuberculosis candidates. However, the enormous genetic diversity of mycobacteriophages poses challenges for the identification of these genes. Here, we used a simple and convenient screening method, based on next-generation sequencing, to identify mycobacteriophage genes encoding toxic products for mycobacteria. Using this approach, we screened and validated several toxic products encoded by mycobacteriophage TM4. In addition, we also found that the genes encoding these toxic products are nonessential for lytic replication of TM4. Our work describes a promising method for the identification of phage genes that encode proteins that are toxic to mycobacteria and which might facilitate the identification of novel antimicrobial molecules.

PMID:37154774 | DOI:10.1128/spectrum.05015-22

Microbiol Resour Announc. 2023 May 8:e0002523. doi: 10.1128/mra.00025-23. Online ahead of print.

ABSTRACT

The draft genome sequence of the soil bacterium Pedococcus sp. strain 5OH_020, isolated on a natural cobalamin analog, comprises 4.4 Mbp, with 4,108 protein-coding genes. Its genome encodes cobalamin-dependent enzymes, including methionine synthase and class II ribonucleotide reductase. Taxonomic analysis suggests that it is a novel species within the genus Pedococcus.

PMID:37154712 | DOI:10.1128/mra.00025-23

Ren Fail. 2023 Dec;45(1):2194440. doi: 10.1080/0886022X.2023.2194440.

ABSTRACT

This study investigated the mechanism of action of ABT-263 in the treatment of neurogenic bladder fibrosis (NBF)and its protective effects against upper urinary tract damage (UUTD). Sixty 12-week-old Sprague-Dawley (SD) rats were randomly divided into sham, sham + ABT-263 (50 mg/kg), NBF, NBF + ABT-263 (25 mg/kg, oral gavage), and NBF + ABT-263 (50 mg/kg, oral gavage) groups. After cystometry, bladder and kidney tissue samples were collected for hematoxylin and eosin (HE), Masson, and Sirius red staining, and Western Blotting (WB) and qPCR detection. Primary rat bladder fibroblasts were isolated, extracted, and cultured. After co-stimulation with TGF-β1 (10 ng/mL) and ABT-263 (concentrations of 0, 0.1, 1, 10, and 100 µmol/L) for 24 h, cells were collected. Cell apoptosis was detected using CCK8, WB, immunofluorescence, and annexin/PI assays. Compared with the sham group, there was no significant difference in any physical parameters in the sham + ABT-263 (50 mg/kg) group. Compared with the NBF group, most of the markers involved in fibrosis were improved in the NBF + ABT-263 (25 mg/kg) and NBF + ABT-263 (50 mg/kg) groups, while the NBF + ABT-263 (50 mg/kg) group showed a significant improvement. When the concentration of ABT-263 was increased to 10 µmol/L, the apoptosis rate of primary bladder fibroblasts increased, and the expression of the anti-apoptotic protein BCL-xL began to decrease.ABT-263 plays an important role in relieving NBF and protecting against UUTD, which may be due to the promotion of myofibroblast apoptosis through the mitochondrial apoptosis pathway.

PMID:37154092 | DOI:10.1080/0886022X.2023.2194440

Front Nutr. 2023 Apr 21;10:1118679. doi: 10.3389/fnut.2023.1118679. eCollection 2023.

ABSTRACT

A previous double-blind, randomized clinical trial of 42 healthy individuals conducted with Lactobacillus johnsonii N6.2 found that the probiotic's mechanistic tryptophan pathway was significantly modified when the data was stratified based on the individuals' lactic acid bacteria (LAB) stool content. These results suggest that confounding factors such as dietary intake which impact stool LAB content may affect the response to the probiotic treatment. Using dietary intake, serum metabolite, and stool LAB colony forming unit (CFU) data from a previous clinical trial, the relationships between diet, metabolic response, and fecal LAB were assessed. The diets of subject groups with high vs. low CFUs of LAB/g of wet stool differed in their intakes of monounsaturated fatty acids, vegetables, proteins, and dairy. Individuals with high LAB consumed greater amounts of cheese, fermented meats, soy, nuts and seeds, alcoholic beverages, and oils whereas individuals with low LAB consumed higher amounts of tomatoes, starchy vegetables, and poultry. Several dietary variables correlated with LAB counts; positive correlations were determined for nuts and seeds, fish high in N-3 fatty acids, soy, and processed meats, and negative correlations to consumption of vegetables including tomatoes. Using machine learning, predictors of LAB count included cheese, nuts and seeds, fish high in N-3 fatty acids, and erucic acid. Erucic acid alone accurately predicted LAB categorization, and was shown to be utilized as a sole fatty acid source by several Lactobacillus species regardless of their mode of fermentation. Several metabolites were significantly upregulated in each group based on LAB titers, notably polypropylene glycol, caproic acid, pyrazine, and chondroitin sulfate; however, none were correlated with the dietary intake variables. These findings suggest that dietary variables may drive the presence of LAB in the human gastrointestinal tract and potentially impact response to probiotic interventions.

PMID:37153913 | PMC:PMC10160632 | DOI:10.3389/fnut.2023.1118679

Front Immunol. 2023 Apr 20;14:1168444. doi: 10.3389/fimmu.2023.1168444. eCollection 2023.

ABSTRACT

The ErbB family of receptor tyrosine kinases is a primary target for small molecules and antibodies for pancreatic cancer treatment. Nonetheless, the current treatments for this tumor are not optimal due to lack of efficacy, resistance, or toxicity. Here, using the novel BiXAb™ tetravalent format platform, we generated bispecific antibodies against EGFR, HER2, or HER3 by considering rational epitope combinations. We then screened these bispecific antibodies and compared them with the parental single antibodies and antibody pair combinations. The screen readouts included measuring binding to the cognate receptors (mono and bispecificity), intracellular phosphorylation signaling, cell proliferation, apoptosis and receptor expression, and also immune system engagement assays (antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity). Among the 30 BiXAbs™ tested, we selected 3Patri-1Cetu-Fc, 3Patri-1Matu-Fc and 3Patri-2Trastu-Fc as lead candidates. The in vivo testing of these three highly efficient bispecific antibodies against EGFR and HER2 or HER3 in pre-clinical mouse models of pancreatic cancer showed deep antibody penetration in these dense tumors and robust tumor growth reduction. Application of such semi-rational/semi-empirical approach, which includes various immunological assays to compare pre-selected antibodies and their combinations with bispecific antibodies, represents the first attempt to identify potent bispecific antibodies against ErbB family members in pancreatic cancer.

PMID:37153618 | PMC:PMC10157173 | DOI:10.3389/fimmu.2023.1168444